Twist۱ antisense oligo nucleotides and inhibition of invasion in advanced prostatic cancer cell line

سال انتشار: 1400
نوع سند: مقاله کنفرانسی
زبان: انگلیسی
مشاهده: 105

نسخه کامل این مقاله ارائه نشده است و در دسترس نمی باشد

این مقاله در بخشهای موضوعی زیر دسته بندی شده است:

استخراج به نرم افزارهای پژوهشی:

لینک ثابت به این مقاله:

شناسه ملی سند علمی:

CHGGE01_414

تاریخ نمایه سازی: 13 مهر 1401

چکیده مقاله:

Backgrounds: According to the statistics provided by the Global Cancer Observatory, prostatecancer is the second prevailing cancer in men worldwide. Androgen independent stage of thedisease happens following bone metastasis. Therefore, it is important to find approaches forpreventing of cancer invasion to other tissues. Twist۱ is transcription factor initiates epithelialmesenchymaltransition process. So, it can be an appropriate target for down regulating leads tometastasis inhibition. In this research, we studied the effect of ۲ antisense oligo nucleotides oninvasion potential of PC۳ cell line.Materials and Methods: PC۳ cell line was used as a model of advanced prostatic cancer cells.Cell invasion assay was done using CytoSelect™ ۱۲-Well Cell Invasion Assay Kit (Cellbiolabs).For this purpose, ۳۰۰ μl of FBS free RPMI medium containing ۰.۷۵*۱۰۶ of PC۳ cells wasincubated for study. ۵۰۰ μl of RPMI with ۱۰ % FBS was used as chemoattractant agent. Twoantisense oligonucleotides were designed readily separately used with concentration of ۵۰۰ nmolas invasion inhibitor. Treatment time was ۴۸ hours in cell culture incubator with ۳۷o C and ۵%CO۲ atmosphere. Finally, invasive cells were stained and results were obtained by measuringOD۵۶۰ in plate reader (BioTek).Results: Antisense oligonucleotide ۱(۵' GTCCTGCATCATCTCTCGAG ۳') was shown ۳۳ %anti-invasive effect on PC۳ cell lines. However, this effect was ۲۹ % for antisenseoligonucleotide ۲ (۵' CACGTCCTGCATCATCTCTC ۳').Conclusion: These results were showed that it is possible to decrease rate of metastasis inmetastatic prostate cancer cell line with down regulating of twist۱ gene and it can increasesurvival chance even in patient with androgen independent grade IV prostate cancer.

کلیدواژه ها:

نویسندگان

Nahid Bakhtiari

Biotechnology Department, Iranian Research Organization for Science and Technology (IROST), Tehran, Iran

Sohameh Mohebbi

Department of Biotechnology, Faculty of science, Ale-Taha institute of Higher Education, Tehran, Iran